View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3252_high_41 (Length: 223)
Name: NF3252_high_41
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3252_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 43513333 - 43513401
Alignment:
| Q |
18 |
gatatacaatttcgttgacggtgtcggggctacctcttacttctatcttacaaagttacaatacatatg |
86 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43513333 |
gatatacaatttggttgacggtgtcggggctacctcttacttctatcttacaaagttacaataaatatg |
43513401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University