View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3252_high_41 (Length: 223)

Name: NF3252_high_41
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3252_high_41
NF3252_high_41
[»] chr2 (1 HSPs)
chr2 (18-86)||(43513333-43513401)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 43513333 - 43513401
Alignment:
18 gatatacaatttcgttgacggtgtcggggctacctcttacttctatcttacaaagttacaatacatatg 86  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
43513333 gatatacaatttggttgacggtgtcggggctacctcttacttctatcttacaaagttacaataaatatg 43513401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University