View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3252_high_43 (Length: 216)
Name: NF3252_high_43
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3252_high_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 4697449 - 4697266
Alignment:
| Q |
14 |
atttggatttcccaccgtgagggaaattttctatcaaacaaattgttggattaaaatcgaattattagagtttacttccaccactattggatgtttttcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4697449 |
atttggatttcccaccgtgagggaaattttctatcaaacaaattgttggattaaaatcgaattattagagtttacttccaccactattggatgtttttcc |
4697350 |
T |
|
| Q |
114 |
taaaagtttgtgaaaatttctagagctgatttactcaaatacattttttccgatataatccttccaaacaaaatcgataagatg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
4697349 |
taaaagtttgtgaaaatttctagagctgatttactcaaatacatttttttggatataatcctttcaaacaaaatcgataagatg |
4697266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University