View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3252_low_15 (Length: 327)
Name: NF3252_low_15
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3252_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 27155758 - 27155658
Alignment:
| Q |
1 |
tgctgccggccaccaactcagttaccagctttggaaaaaaccctctgccatatccaagggtaccttaaacctctcctacaaattcggtgatcgtgtcaaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||| || |||||||||||||| || ||||| ||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27155758 |
tgctgctggccaccaactcagttaccaggttaggaaaaaaccctctcacaaatccaggggtagcttaaacctctcctacaaatttggtgatcgtgtcaaa |
27155659 |
T |
 |
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
27155658 |
g |
27155658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 15275676 - 15275757
Alignment:
| Q |
13 |
ccaactcagttaccagctttggaaaaaaccctctgccatatccaagggtaccttaaacctctcctacaaattcggtgatcgt |
94 |
Q |
| |
|
|||||||||||| ||| || ||||||||| |||| | ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15275676 |
ccaactcagttatcaggttaggaaaaaacgctctcggaaatccaagggtaccttaaacctctcctacaaatttggtgatcgt |
15275757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 223 - 292
Target Start/End: Complemental strand, 27155511 - 27155442
Alignment:
| Q |
223 |
taaatataaaataactttcatctaatttgatcttgcgttttttcttttatcttttatataagcgacatat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | | |||||||||||||||||| ||||||| |
|
|
| T |
27155511 |
taaatataaaataactttcatctaatttgatcttatgtgtctgattttatcttttatataagtgacatat |
27155442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 101
Target Start/End: Original strand, 15251579 - 15251624
Alignment:
| Q |
56 |
aagggtaccttaaacctctcctacaaattcggtgatcgtgtcaaag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
15251579 |
aagggtaccttaaacctctcctacaaatttggtgatcatgtcaaag |
15251624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University