View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3252_low_23 (Length: 289)
Name: NF3252_low_23
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3252_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 6 - 278
Target Start/End: Original strand, 46783796 - 46784068
Alignment:
| Q |
6 |
acactgttcatgttaaagctcagcatgatattgttttttgtctacaaacctcttctgactatatattattattgtcagcattgtatatgacttataatta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46783796 |
acactgttcatgttaaagctcagcatgatattgttttttgtctacaaacctcttctgactatatattattattgtcagcattatatatgacttataatta |
46783895 |
T |
|
| Q |
106 |
agttccaattctaattcatgtattcccattgatttagttagtttctgaaagtaatttccctaatgactgcttgttttgactaacagattacaactgagtt |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46783896 |
agtttcaattctaattcatgtattcccattgatttagatagtttctgaaagtaatttccctaatgactgcttgttttgactaacagattacaactgagtt |
46783995 |
T |
|
| Q |
206 |
ccaatttatttttcagtaatcatgttattgagttttcaccaaaatctttggttggccacctataatggtctct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46783996 |
ccaatttatttttcagtaatcatgttattgagttttcaccaaaatctttggttggccacctataatggtctct |
46784068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University