View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3252_low_36 (Length: 238)

Name: NF3252_low_36
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3252_low_36
NF3252_low_36
[»] chr8 (1 HSPs)
chr8 (1-221)||(8877435-8877655)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 8877655 - 8877435
Alignment:
1 tttattttgattgcatgaactaggtttttcttaacctcaacaagtattggaatggagatcccaactcgatgtggaagataactttcacgagtactttcgc 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||| |||||||| ||||||||||||    
8877655 tttattttgattgcatgaactaggtttttcttaaccttaacaagtattggaatcgagatcccaactcgaggtggaagacaactttcatgagtactttcgc 8877556  T
101 atttattggcaaaacaaaacaatctccaaggataattttcaaagataagctaatcaaactagtttcatctaaccattttttagcaccatgttggatttca 200  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||  |||||||    
8877555 atttattcgcaaaacaaaacaatctccaaggataattttcaaagataagctaatcaaactagttccatctaaccattttttagcaccatgtcagatttca 8877456  T
201 tacataatcatcttcaggatg 221  Q
    |||||||||||||||||||||    
8877455 tacataatcatcttcaggatg 8877435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University