View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3252_low_43 (Length: 216)

Name: NF3252_low_43
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3252_low_43
NF3252_low_43
[»] chr1 (1 HSPs)
chr1 (14-197)||(4697266-4697449)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 4697449 - 4697266
Alignment:
14 atttggatttcccaccgtgagggaaattttctatcaaacaaattgttggattaaaatcgaattattagagtttacttccaccactattggatgtttttcc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4697449 atttggatttcccaccgtgagggaaattttctatcaaacaaattgttggattaaaatcgaattattagagtttacttccaccactattggatgtttttcc 4697350  T
114 taaaagtttgtgaaaatttctagagctgatttactcaaatacattttttccgatataatccttccaaacaaaatcgataagatg 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||| ||||||||||||||||||||    
4697349 taaaagtttgtgaaaatttctagagctgatttactcaaatacatttttttggatataatcctttcaaacaaaatcgataagatg 4697266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University