View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_high_14 (Length: 355)
Name: NF3253_high_14
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 1329503 - 1329669
Alignment:
| Q |
1 |
ttatggaagagtttatcaaagataagaacatgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329503 |
ttatggaagagtttatcaaagataagaacatgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccga |
1329602 |
T |
|
| Q |
101 |
acccgaacctgaaccggaagaggatatgaatgaagtcaaggcccttccaccaccagaggaaccagcc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1329603 |
acccgaacctgaaccggaagaggatatgaatgcagtcaaggcccttccaccaccagaggaaccagcc |
1329669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 217 - 336
Target Start/End: Original strand, 1329719 - 1329838
Alignment:
| Q |
217 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaacttgccttagctttatttgatggggctgc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1329719 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaactagccttagctttatttgatggggctgc |
1329818 |
T |
|
| Q |
317 |
accagcaacaagtgaaggtg |
336 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1329819 |
accagcaacaagtgaaggtg |
1329838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University