View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_high_26 (Length: 249)
Name: NF3253_high_26
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 1487739 - 1487500
Alignment:
| Q |
1 |
attaaataaaccaaaaacggttgaaaaccccaaaaacttctacggatagttcacaaactgaacttgacagttcgattctttttggtacagtttggttcgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1487739 |
attaaataaaccaaaaacggttgaaaaccccaaaaacttctacggatagttcacaaactgaacttgacagttcgattctttttggtacagtttggttcgc |
1487640 |
T |
|
| Q |
101 |
ttttacggatcaattgnnnnnnnnnnnnnnnnnattaagacccaggttacaggcaaatgcggttgttgtggctgaaattgtggtcaagatacagtcacat |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1487639 |
ttttacggatcaattgttttttgtttttgttttattaagacccaagttactggcaaatgcggttgttgtggctgaaattgtggtcaagatacagtcacat |
1487540 |
T |
|
| Q |
201 |
aagaatttgatataatgatatgttatattattatttcatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1487539 |
aagaatttgatataatgatatgttatattattatttcatc |
1487500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University