View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_high_42 (Length: 210)
Name: NF3253_high_42
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_high_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 90 - 202
Target Start/End: Original strand, 35078098 - 35078210
Alignment:
| Q |
90 |
tggcaaaactctctctgcagagatttatcactgctgcattcctagagcttgatttgaacccatgaccttcttgggtctatgtgataccttttgtgctatg |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35078098 |
tggcaaaactctctctgaagagatttatctctgctgcattcctagagcttgatttgaacccatgaccttcttgggtctatgtgataccttttgtgctatg |
35078197 |
T |
|
| Q |
190 |
gtcttgatgatgt |
202 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
35078198 |
gtctttatgatgt |
35078210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 24 - 97
Target Start/End: Complemental strand, 35078008 - 35077935
Alignment:
| Q |
24 |
aattttatggtggtttggttcaagtttaaccctttcgtaacaattagctagattaccattaacacatggcaaaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35078008 |
aattttatggtggtttggttcaagtttaaccctttcgtagcaattagctagattaccattaacacatggcaaaa |
35077935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University