View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_high_43 (Length: 204)
Name: NF3253_high_43
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_high_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 20 - 143
Target Start/End: Original strand, 32325678 - 32325801
Alignment:
| Q |
20 |
ttaaaaggggtaaaaggagaaagnnnnnnntatctatgatgtctcttcaccctctcttaccacaatataatacctattgacagtagtatatctcaactcc |
119 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
32325678 |
ttaaaaggggtaaaaggagaaagaaaaaaatatctatgatgtctcttcaccctctcttaccgcaatataataccgattgacagcagtatatctcgactcc |
32325777 |
T |
 |
| Q |
120 |
ttgagaggttgccgagacatcaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32325778 |
ttgagaggttgccgagacatcaaa |
32325801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University