View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_high_45 (Length: 203)
Name: NF3253_high_45
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 774565 - 774735
Alignment:
| Q |
18 |
agagcagcaacaggtaatccaagattataaaattcagcaaaatctcttgtaatgaaattttgtctccatccaggagcaaatactgtgtgcctacaaggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
774565 |
agagcagcaacaggtaatccaagattgtaaaattcagcaaaatctcttgtaatgaaattttgtctccatccaggagctaatactgtgtgcctacaaggtt |
774664 |
T |
 |
| Q |
118 |
gcctaaacaacacaaatatcacacgatgaattcctgatgttggtcttggattttcataactcactatctct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
774665 |
gcctaaacaacacaaatatcacacgatgaatccctgatgttggtcttggattttcatagctcactatctct |
774735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 814498 - 814668
Alignment:
| Q |
18 |
agagcagcaacaggtaatccaagattataaaattcagcaaaatctcttgtaatgaaattttgtctccatccaggagcaaatactgtgtgcctacaaggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
814498 |
agagcagcaacaggtaatccaagattgtaaaattcagcaaaatctcttgtaatgaaattttgtctccatccaggagctaatactgtgtgcctacaaggtt |
814597 |
T |
 |
| Q |
118 |
gcctaaacaacacaaatatcacacgatgaattcctgatgttggtcttggattttcataactcactatctct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
814598 |
gcctaaacaacacaaatatcacacgatgaatccctgatgctggtcttggactttcataactcactatctct |
814668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 32845237 - 32845162
Alignment:
| Q |
20 |
agcagcaacaggtaatccaagattataaaattcagcaaaatctcttgtaatgaaattttgtctccatccaggagca |
95 |
Q |
| |
|
||||||||||||| |||||||||| || | ||||||||| |||||||| |||||||||||| |||||| |||||| |
|
|
| T |
32845237 |
agcagcaacaggtgatccaagattgtagagttcagcaaattctcttgtgttgaaattttgtcgccatcctggagca |
32845162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 32865739 - 32865664
Alignment:
| Q |
20 |
agcagcaacaggtaatccaagattataaaattcagcaaaatctcttgtaatgaaattttgtctccatccaggagca |
95 |
Q |
| |
|
||||||||| || |||||||||| ||||||||| || ||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
32865739 |
agcagcaaccggcgatccaagattgtaaaattcaatgaattctcttgtattgaaattttgtcgccatcccggagca |
32865664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University