View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_low_14 (Length: 391)
Name: NF3253_low_14
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 40511745 - 40511954
Alignment:
| Q |
18 |
actttctaccggagaactggacgttgggaatctcatatttggttcgcatttcgcaatcgattattctgtttcttcgtagttcagttcactttctgcattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40511745 |
actttctaccggagaactggacgttgggaatctcatatttggttcgcatttcgcaatcgattattctgtttcttcgtagttcagtttactttctgcattt |
40511844 |
T |
|
| Q |
118 |
catgatagtgttgtttctgaatccactctgttttcgtttttctgcagggattgtggaaaacaagtatacttaggtgagaaatcattactgattaagtgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40511845 |
catgatagtgttgtttctgaatccactctgttttcgtttttctgcagggattgtggaaaacaagtatacttaggtgagaaatcattactgattaagtgat |
40511944 |
T |
|
| Q |
218 |
tatttgagac |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
40511945 |
tatttgagac |
40511954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 334
Target Start/End: Complemental strand, 22122448 - 22122412
Alignment:
| Q |
298 |
caggtggatttgataccgcgcatgctgcggcaaggta |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22122448 |
caggtggatttgataccgcgcatgctgcggcaaggta |
22122412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 334
Target Start/End: Original strand, 40512025 - 40512061
Alignment:
| Q |
298 |
caggtggatttgataccgcgcatgctgcggcaaggta |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40512025 |
caggtggatttgataccgcgcatgctgcggcaaggta |
40512061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University