View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3253_low_15 (Length: 355)

Name: NF3253_low_15
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3253_low_15
NF3253_low_15
[»] chr2 (2 HSPs)
chr2 (1-167)||(1329503-1329669)
chr2 (217-336)||(1329719-1329838)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 1329503 - 1329669
Alignment:
1 ttatggaagagtttatcaaagataagaacatgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329503 ttatggaagagtttatcaaagataagaacatgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccga 1329602  T
101 acccgaacctgaaccggaagaggatatgaatgaagtcaaggcccttccaccaccagaggaaccagcc 167  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
1329603 acccgaacctgaaccggaagaggatatgaatgcagtcaaggcccttccaccaccagaggaaccagcc 1329669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 217 - 336
Target Start/End: Original strand, 1329719 - 1329838
Alignment:
217 ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaacttgccttagctttatttgatggggctgc 316  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
1329719 ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaactagccttagctttatttgatggggctgc 1329818  T
317 accagcaacaagtgaaggtg 336  Q
    ||||||||||||||||||||    
1329819 accagcaacaagtgaaggtg 1329838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University