View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_low_22 (Length: 262)
Name: NF3253_low_22
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 49699195 - 49698965
Alignment:
| Q |
17 |
agatatctcctcgcaataggcccatggctatccacaagcaaatacgtagttttgtcatagtaagcaacaaagaaagttaaccaaatatcaaagaaaaata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49699195 |
agatatctcctcgcaataggcccatggctatccacaagcaaatacgtagttttgtcatagtaagcaacaaagaaagttaaccaaatatcaaagaaaaata |
49699096 |
T |
 |
| Q |
117 |
ttatattcacaacattatcagtaattgaaagaggtctcaaaggttcattcaagaacccgaattcaaatggtgacacccatgcagtgtagaacactaacac |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49699095 |
ttatattcacaacattatcagtaatcgaaagaggtctcaaaggttcattcaagaacccgaattcaaatggtgacacccatgcagtgtagaacactaacac |
49698996 |
T |
 |
| Q |
217 |
caccaaaaacatctgccaccatctgcatgcc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49698995 |
caccaaaaacatctgccaccatctgcatgcc |
49698965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University