View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_low_29 (Length: 245)
Name: NF3253_low_29
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 35077555 - 35077772
Alignment:
| Q |
19 |
cttcaaccttcaaaaccttctctagatcccctttttagatcatacataaatttcatcattatgcttcaaagatgttagattttgtttcatgcaacctttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35077555 |
cttcaaccttcaaaaccttctctagatcccctttttagatcatacataaatttcatcattatgcttcaaaaatgttagattttgtttcatgcaacctttt |
35077654 |
T |
 |
| Q |
119 |
ctttatttagatttcatcaaaatcttatctttatatgctcaattgttgatctgattttgttaccacaggtttaagcaacaaagatcttaactttacctct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35077655 |
ctttatttagatttcatcaaaatcttatctttatatgctcaattgttgatctgattttgttaccacaggtttaagcaacaaagatcttaactttgcctct |
35077754 |
T |
 |
| Q |
219 |
cgctgtgttctttcatct |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35077755 |
cgctgtgttctttcatct |
35077772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University