View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3253_low_35 (Length: 240)
Name: NF3253_low_35
Description: NF3253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3253_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 131 - 226
Target Start/End: Original strand, 36281680 - 36281775
Alignment:
| Q |
131 |
atattccaaaagaaagagtcagtgcatgtttgaataaacgcgttaataaaattacggcaacaccgtgatttttgaagttttaaaatgcagtttttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36281680 |
atattccaaaagaaagagtcagtgcatgtttgaataaacgcgttaataaaattacggcaacaccgtgatttttgaagttttaaaatgtagtttttg |
36281775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 36281552 - 36281605
Alignment:
| Q |
1 |
cttcccaaatcggtagcaaggacaactgcaacacccaaatgtttgattgttaac |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281552 |
cttcccaaatcggtagcaaggacaactgcaacacccaaatgtttgattgttaac |
36281605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University