View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3254_high_1 (Length: 389)
Name: NF3254_high_1
Description: NF3254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3254_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 18 - 370
Target Start/End: Complemental strand, 37234236 - 37233882
Alignment:
| Q |
18 |
aattcaagggttttggtttcaagtggttctgaagagtttgtggattgtttagttggtggttctaaattcaagtctatgcttgttcttcatgactcacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37234236 |
aattcaagggttttggtttcaagtggttctgaagagtttgtggattgtttagttggtggttctaaattcaagtctatgcttgttcttcatgactcacttt |
37234137 |
T |
 |
| Q |
118 |
tgatattggctcttcttattgagaaatatgataatattaagtgttggcaaggagaggttactattgttccggaaaaatggtctccttttgatgttgtgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37234136 |
tgatattggctcttcttattgagaaatatgataatattaagtgttggcaaggagaggttactattgttccggaaaaatggtctccttttgatgttgtgtt |
37234037 |
T |
 |
| Q |
218 |
tctttattttttgcctgctttgccctttaaacttgaggatgttcttggttctttggctccaaaatgttcacctggttagtttttcttatctgctttagaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37234036 |
tctttattttttgcctgctttgccctttaaacttgaggatgttcttggttctttggctccaaaatgttcacctggttagtttttcttatctgctttagaa |
37233937 |
T |
 |
| Q |
318 |
--ttttgttgttagtttagtattggaatagaaaattgttcattcatgtttatgtc |
370 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37233936 |
tgttttgttgttagtttactattggaatagaaaattgttcattcatgtttatgtc |
37233882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University