View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3255_high_10 (Length: 235)
Name: NF3255_high_10
Description: NF3255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3255_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2930625 - 2930404
Alignment:
| Q |
1 |
taattgagatagctcttgatggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930625 |
taattgagatagctcttgatggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgcag |
2930526 |
T |
|
| Q |
101 |
ggagttttccggcgaggaggaggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtattactatcatgtgattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930525 |
ggagttttccggcgaggaggaggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtattactatcatgtgattt |
2930426 |
T |
|
| Q |
201 |
ggtttggggataagtgaaaggt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2930425 |
ggtttggggataagtgaaaggt |
2930404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 36117578 - 36117626
Alignment:
| Q |
45 |
tttcagtatgaggaagagaatatgattgaaattgatatttctccgacga |
93 |
Q |
| |
|
|||||||| || ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
36117578 |
tttcagtacgaagaagagaatttgattgagattgatatttctccgacga |
36117626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University