View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3255_high_11 (Length: 222)
Name: NF3255_high_11
Description: NF3255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3255_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 21266314 - 21266129
Alignment:
| Q |
17 |
gagaattcggagttctaacactgactccatcagtgagtagatttatagctacgaaataagctacacttgcagaacaaacatattgttaaagacagtggag |
116 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
21266314 |
gagaattcggagttctaacattgacttcagcagtgggtagatttatagctacgaaataagctacacttacgaaacaaacatattgttaaagacagtggag |
21266215 |
T |
|
| Q |
117 |
cggtcaacgtcgaatatggaatagacgctcttgttaatatcacatagagtggagttaagatacaacaaaggtatatcattggaaaaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21266214 |
cggtcaacgtcgaatatggaatagacgctcttgttaatatcacggagagtggagttaagatacaacaaaggtata--attggaaaaaa |
21266129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University