View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3255_high_13 (Length: 205)

Name: NF3255_high_13
Description: NF3255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3255_high_13
NF3255_high_13
[»] chr7 (1 HSPs)
chr7 (39-187)||(32524182-32524330)
[»] chr1 (1 HSPs)
chr1 (39-163)||(19769887-19770011)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 39 - 187
Target Start/End: Original strand, 32524182 - 32524330
Alignment:
39 gaggtaatcgcggagcatctggattcttcaatgcctcgatatagcattacggcgacgattcaatttcaaacgttgaggtgatgcttagatctaattctct 138  Q
    |||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
32524182 gaggtaatcgcggagcatttggattcttccatgcctcgagatagcattacggcgacgattcaattttaaacgttgaggtgatgcttagatctaattctct 32524281  T
139 tatgatatcagattattcactatgagaaatgattcatacttagtgcttt 187  Q
    |||||||||| |||||||| |||||||||||||||||||||||||||||    
32524282 tatgatatcatattattcattatgagaaatgattcatacttagtgcttt 32524330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 39 - 163
Target Start/End: Original strand, 19769887 - 19770011
Alignment:
39 gaggtaatcgcggagcatctggattcttcaatgcctcgatatagcattacggcgacgattcaatttcaaacgttgaggtgatgcttagatctaattctct 138  Q
    ||||||||||||||||||||||||||||| ||||||||| |||||||||||| | |||||||||||||||||||||||||||||||| ||||  ||||||    
19769887 gaggtaatcgcggagcatctggattcttccatgcctcgagatagcattacggtggcgattcaatttcaaacgttgaggtgatgcttatatctgcttctct 19769986  T
139 tatgatatcagattattcactatga 163  Q
    ||| |||||||||||||||||||||    
19769987 tatcatatcagattattcactatga 19770011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University