View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3255_high_13 (Length: 205)
Name: NF3255_high_13
Description: NF3255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3255_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 39 - 187
Target Start/End: Original strand, 32524182 - 32524330
Alignment:
| Q |
39 |
gaggtaatcgcggagcatctggattcttcaatgcctcgatatagcattacggcgacgattcaatttcaaacgttgaggtgatgcttagatctaattctct |
138 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32524182 |
gaggtaatcgcggagcatttggattcttccatgcctcgagatagcattacggcgacgattcaattttaaacgttgaggtgatgcttagatctaattctct |
32524281 |
T |
|
| Q |
139 |
tatgatatcagattattcactatgagaaatgattcatacttagtgcttt |
187 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32524282 |
tatgatatcatattattcattatgagaaatgattcatacttagtgcttt |
32524330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 39 - 163
Target Start/End: Original strand, 19769887 - 19770011
Alignment:
| Q |
39 |
gaggtaatcgcggagcatctggattcttcaatgcctcgatatagcattacggcgacgattcaatttcaaacgttgaggtgatgcttagatctaattctct |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||| | |||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
19769887 |
gaggtaatcgcggagcatctggattcttccatgcctcgagatagcattacggtggcgattcaatttcaaacgttgaggtgatgcttatatctgcttctct |
19769986 |
T |
|
| Q |
139 |
tatgatatcagattattcactatga |
163 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
19769987 |
tatcatatcagattattcactatga |
19770011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University