View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3255_high_9 (Length: 250)
Name: NF3255_high_9
Description: NF3255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3255_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 48043468 - 48043231
Alignment:
| Q |
1 |
ctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcatcgaagggatgatattggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48043468 |
ctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcattgaagggatgatattggtg |
48043369 |
T |
|
| Q |
101 |
tatcatactactagtttttcttttccatatttgactggctttaaatccaatctgatagcctgtgataactaggtttaccaacaaaggtatcaaagagagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043368 |
tatcatactactagtttttcttttccatatttgactggctttaaatccaatctgatagcttgtaataactaggtttaccaacaaaggtatcaaagagagt |
48043269 |
T |
|
| Q |
201 |
attatacttatttacctaccatacaggttcacaatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043268 |
attatacttatttacctaccatacaggttcacaatatt |
48043231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 48056686 - 48056587
Alignment:
| Q |
1 |
ctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcatcgaagggatgatattggtg |
100 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48056686 |
ctaacgcaaagaactgaagctctcaacttctgccctaggattctatttgaatgttacattgcagactgatatcaaggtcattgaagggatgatattggtg |
48056587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 48051410 - 48051312
Alignment:
| Q |
1 |
ctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcatcgaagggatgatattggt |
99 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| | |||| |||||| ||||| |
|
|
| T |
48051410 |
ctaaagcaaacaattgaagctctcaactcttgccatatgaatcaatttgaatgttacattgcagactgatatcaaggtctttgaagagatgatgttggt |
48051312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 48037420 - 48037329
Alignment:
| Q |
1 |
ctaaagcaaacaactgaagctctcaa-cttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcatcgaagggatg |
91 |
Q |
| |
|
|||||||||| |||| |||||||||| |||||||| | |||||||||||||||||| ||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
48037420 |
ctaaagcaaagaacttaagctctcaaacttctgccctgtgaatctatttgaatgttgcattgcagactgatatcaatgtcatggtagggatg |
48037329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 161 - 216
Target Start/End: Complemental strand, 48051209 - 48051154
Alignment:
| Q |
161 |
tgtgataactaggtttaccaacaaaggtatcaaagagagtattatacttatttacc |
216 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48051209 |
tgtgatagcttggtttaccaacaaaggtatcaaagagagtattatacttatttacc |
48051154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 48045258 - 48045200
Alignment:
| Q |
20 |
ctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggt |
78 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
48045258 |
ctctcaactcctgccctatgaatctatttgaatgttgcattgcagattgatatcaaggt |
48045200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 200
Target Start/End: Complemental strand, 48056532 - 48056495
Alignment:
| Q |
163 |
tgataactaggtttaccaacaaaggtatcaaagagagt |
200 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
48056532 |
tgataacttggtttaccatcaaaggtatcaaagagagt |
48056495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University