View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3257_high_15 (Length: 252)
Name: NF3257_high_15
Description: NF3257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3257_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 11745955 - 11746199
Alignment:
| Q |
1 |
ttggttgattttttgtgacccttttattggtttgtactttttacctaacaagttattattaagataataatattgtcttaaaggacaagagaaagttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11745955 |
ttggttgattttttgtgacccttttattggcttgtactttttacctaacaagttattattcagataataatattgtcttaaaggacaagagaaagttcca |
11746054 |
T |
 |
| Q |
101 |
atctttatggctttgtttgtttgtattcaatattcatggtgnnnnnnnnnnnnnnngaaagcttcatggtgtatttctgcttttgtaacatgtgctacat |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
11746055 |
atctttatggttttgtttgtttgtattcaatattcatggtgtttttctttatttttgaaagcttcatggtgtttttctgcttttgtaacatatgctacat |
11746154 |
T |
 |
| Q |
201 |
tataactctgaatcaagttaagagctttttaacttctctctgctc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11746155 |
tataactctgaatcaagttaagagctttttaacttctttctgctc |
11746199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University