View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3257_high_9 (Length: 343)
Name: NF3257_high_9
Description: NF3257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3257_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 8206326 - 8206549
Alignment:
| Q |
15 |
aaaacaaacacccaactacaannnnnnngtcgcaattactacagattaatataacatgttggtcatgtgtttcacgtggaataataaaa-ttgtatatct |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8206326 |
aaaacaaacacccaactacaatttttttgtcgcaattactacagattaatataacatgttggtcatgtgtttcacgtggaataataaaaattgtatatct |
8206425 |
T |
 |
| Q |
114 |
tagtaaaagaaataaaataatgttataatgttgctatagccttttaataattttgttagcctgttaaaatatccggtggctaaacaattttccattttta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8206426 |
tagtaaaagaaataaaataatgttataatgttgctatagccttttaataattttgttagcctgttaaaatatccggtggctaaacaattttccattttta |
8206525 |
T |
 |
| Q |
214 |
aagacttggtgatgtgcttatgag |
237 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
8206526 |
aagacttgatgatgtgcttatgag |
8206549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 289 - 334
Target Start/End: Original strand, 8206601 - 8206646
Alignment:
| Q |
289 |
gacttggtgtgcgttgaacaaaggttcattctaaattgggtctctg |
334 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8206601 |
gacttggtgtgcgttgaacaaagattcattctaaattgggtttctg |
8206646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University