View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3257_low_13 (Length: 308)
Name: NF3257_low_13
Description: NF3257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3257_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 44599556 - 44599293
Alignment:
| Q |
18 |
gaagaaaggaaaagcatggggaaaagggaaattctcatggccatcaggagcaacttatgaaggtgattttatttcaggggctatggaaggttctggaact |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44599556 |
gaagaaaggaaaagcatgggggaaagggaaattctcatggccatcaggagcaacttatgaaggtgattttatttcaggggctatggaaggttctggtact |
44599457 |
T |
|
| Q |
118 |
tttgttggtgtggaaggtgatacttataaaggtgagtgggtttctgataggaaacatgggtttggtgagaaatgttatgctaatggtgatgtgtatgagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44599456 |
tttgttggtgtggaaggtgatacttataaaggtgagtgggtttctgataggaaacatgggtttggtgagaaatgttatgctaatggtgatgtgtatgagg |
44599357 |
T |
|
| Q |
218 |
gatggtggaggtgcaatttgcaagatggggaagggaggtatatgtggaggaatggtaatgagta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44599356 |
gatggtggaggtgcaatttgcaagatggggaagggaggtatatgtggaggaatggtaatgagta |
44599293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 161 - 265
Target Start/End: Complemental strand, 39807736 - 39807632
Alignment:
| Q |
161 |
ctgataggaaacatgggtttggtgagaaatgttatgctaatggtgatgtgtatgagggatggtggaggtgcaatttgcaagatggggaagggaggtatat |
260 |
Q |
| |
|
||||||| ||| ||||||| ||||||||| ||||| |||||||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||| | |
|
|
| T |
39807736 |
ctgatagaaaaaatgggttcggtgagaaacgttatagtaatggtgatgtgtatgaaggatggtggaggtgtaacttgcaagatggtgaaggaaggtatgt |
39807637 |
T |
|
| Q |
261 |
gtgga |
265 |
Q |
| |
|
||||| |
|
|
| T |
39807636 |
gtgga |
39807632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University