View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3258_low_1 (Length: 467)
Name: NF3258_low_1
Description: NF3258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3258_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 121 - 418
Target Start/End: Complemental strand, 34262389 - 34262104
Alignment:
| Q |
121 |
ccgctacaataattggtatttcttttgtgtatgaaaaaattcttcatttttctctttttatgtgtaactctgtctcaaaacatagcacaaaacagagtac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34262389 |
ccgctacaataattggtatttcttttgtgtatgaagaaattcttcatttctctctttttatgtgtaactctgtctcaaaaca------------gagtac |
34262302 |
T |
|
| Q |
221 |
tctgtttttgtatcattgcatttgctttatcaatgttctatgctaacttttcacattttgtttattctgaatcagtgctattactacattgcattgtttt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34262301 |
tctgtttttgtatcattgcatttgctttatcaatgttctatgctaacttttcacattttgtttattctgaatcagtgctattactacattgcattgtttt |
34262202 |
T |
|
| Q |
321 |
ctgagaaaaattggaagaaaaaatgaatgctagagcacgctcaactcttcattcaatcaaagtaacttctctttcttctacttctgcttcttcaagac |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
34262201 |
ctgagaaaaattggaagaaaaaatgaatgctagagcacgctcaactcttcattcaatcaaagtaacttctcttccttcttcttctgcttcttcaagac |
34262104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 34262492 - 34262456
Alignment:
| Q |
18 |
aacaacaccattaataatattaataaatatgtaaaaa |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34262492 |
aacaacaccattaataatattaataaatatgtaaaaa |
34262456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University