View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3259_high_18 (Length: 240)

Name: NF3259_high_18
Description: NF3259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3259_high_18
NF3259_high_18
[»] chr8 (1 HSPs)
chr8 (1-222)||(18453159-18453380)


Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 18453159 - 18453380
Alignment:
1 actacaatgaaatttttaaggtttttactttaatcttatctttcttggtcagtttcgtgtaacatagaaatggtgaaaaatcatatcatagaatttagta 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||    
18453159 actacaatgaactttttaaggtttttactttaatcttatctttcttggtcagtttcctgtaacatagaaatggtgaaaattcatatcatagaagttagta 18453258  T
101 tatgacatgaatagaagggaatacatgggaacgtgtgtaaaaaatgtattgatagcttgtgattcaggatttctttatagggtgattctgctgttattaa 200  Q
    | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
18453259 tctgacatgaatagaagggaatacatgggaacgtgtggaaaaaatgtattgatagcttgtgattcaggatttctttatagggtaattctgctgttattaa 18453358  T
201 ttagtggtaatggttgtagtat 222  Q
    ||||||||||||||||||||||    
18453359 ttagtggtaatggttgtagtat 18453380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University