View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3259_low_15 (Length: 264)
Name: NF3259_low_15
Description: NF3259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3259_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 46618577 - 46618815
Alignment:
| Q |
19 |
acctggaagaggaaaagaagtgaccaagtttcttctgtaggcgttgtttggctttgaaagcagtttcatctaaggtagtagtcattgaagtccatggtgc |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618577 |
accttgaagaggaaaagaagtgaccaagtttcttctgtaggcgttgtttggctttgaaagcagtttcatctaaggtagtagtcattgaagtccatggtgc |
46618676 |
T |
 |
| Q |
119 |
atccaatgattcctttaggtaagagtctctgtaggtagcataatgttcatgtctgttgtgataatgttctgatcttttccttggtgacaatccaacacca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618677 |
atccaatgattcctttaggtaagagtctctgtaggtagcataatgttcatgtctgttgtgataatgttctgatcttttccttggtgacaatccaacacca |
46618776 |
T |
 |
| Q |
219 |
ggtagcctaccagccattcactcttctttacctatgctt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46618777 |
ggtagcctaccagccattcactcttctttacctaagctt |
46618815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University