View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3259_low_18 (Length: 240)
Name: NF3259_low_18
Description: NF3259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3259_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 18453159 - 18453380
Alignment:
| Q |
1 |
actacaatgaaatttttaaggtttttactttaatcttatctttcttggtcagtttcgtgtaacatagaaatggtgaaaaatcatatcatagaatttagta |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
18453159 |
actacaatgaactttttaaggtttttactttaatcttatctttcttggtcagtttcctgtaacatagaaatggtgaaaattcatatcatagaagttagta |
18453258 |
T |
|
| Q |
101 |
tatgacatgaatagaagggaatacatgggaacgtgtgtaaaaaatgtattgatagcttgtgattcaggatttctttatagggtgattctgctgttattaa |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18453259 |
tctgacatgaatagaagggaatacatgggaacgtgtggaaaaaatgtattgatagcttgtgattcaggatttctttatagggtaattctgctgttattaa |
18453358 |
T |
|
| Q |
201 |
ttagtggtaatggttgtagtat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18453359 |
ttagtggtaatggttgtagtat |
18453380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University