View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3262_high_8 (Length: 244)
Name: NF3262_high_8
Description: NF3262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3262_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 19343450 - 19343669
Alignment:
| Q |
1 |
ccttttactggaatgatgatttctttgatgggtcgtcttaatcgaacacatgtatgcatctatgttgttattgttgcattagtaactaactaattaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||| | |
|
|
| T |
19343450 |
ccttttactggaatgatgatttctttgatgggtcgtcttaatcgaacacatgtatgtatctatgttattattgttgcattag----taactaattaacca |
19343545 |
T |
|
| Q |
101 |
actgctactgagttttgttgattggattttgtttttggttacttagcaatattggnnnnnnncaattgaaaagcatggagggaaggtggcaaactctatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19343546 |
actgctactgagttttgttgattggattttgtttctggctacttagcaatattggaaaaaaacaattgaaaagcatggagggaaggtggcaaactctatc |
19343645 |
T |
|
| Q |
201 |
attggtaatgtgatagaattttct |
224 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
19343646 |
attggtaatgtaatagaattttct |
19343669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University