View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3262_high_9 (Length: 240)
Name: NF3262_high_9
Description: NF3262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3262_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 14398468 - 14398678
Alignment:
| Q |
14 |
agatatacacacatgaattagttataacatgatcacatagtttattgttttgacaattgtagattgattgggtttggatattggttagcatgtcacgtga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
14398468 |
agatatacacacatgaattagttataacatgatcacgtagtttattgttttgacaattgtagattgattggatttggatattggttatcatgtcatgtga |
14398567 |
T |
|
| Q |
114 |
gttgagttgagcatgatgtattaattttaggatcaattatacaatatacatagaactacaggagtatataggaatccggtttactatgctcaacacatta |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14398568 |
gttgagttgagcatgatggtttaattttaggatcaattatgcaatatacatagaactacaggagtatatagcaatccggtttactatgctcaacacatta |
14398667 |
T |
|
| Q |
214 |
aataataaatc |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
14398668 |
aataataaatc |
14398678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University