View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3263_high_13 (Length: 231)

Name: NF3263_high_13
Description: NF3263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3263_high_13
NF3263_high_13
[»] chr1 (2 HSPs)
chr1 (14-215)||(36634462-36634663)
chr1 (74-184)||(36639287-36639400)
[»] chr7 (1 HSPs)
chr7 (115-206)||(46937371-46937462)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 36634462 - 36634663
Alignment:
14 ataacaatgaatttgttacgttttttattgaaaacattcttgacttgaactccacagtagaaaaattgttttgctgaaattaacattcactctcttattt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36634462 ataacaatgaatttgttacgttttttattgaaaacattcttgacttgaactccacagtagaaaaattgttttgctgaaattaacattcactctcttattt 36634561  T
114 gtgatagagactatatgaccacggggctaggaatttttgggtacataacacaggtccacttggatgcttgggtcaaaatgttgccacatttggccatgat 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36634562 gtgatagagactatatgaccacggggctaggaatttttgggtacataacacaggtccacttggatgcttgggtcaaaatgttgccacatttggccatgat 36634661  T
214 aa 215  Q
    ||    
36634662 aa 36634663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 74 - 184
Target Start/End: Original strand, 36639287 - 36639400
Alignment:
74 aaaaattgttttgctgaaattaacattc-actctcttatttgtg--atagagactatatgaccacggggctaggaatttttgggtacataacacaggtcc 170  Q
    |||||| ||| ||| |||||| |||||| |||||||||||||||  | ||||||| ||||||  |||||  ||||||||| || |||||||| |  ||||    
36639287 aaaaatagttatgcagaaattgacattccactctcttatttgtgtgacagagactgtatgacatcggggtcaggaattttcggatacataacgcgagtcc 36639386  T
171 acttggatgcttgg 184  Q
    ||||||||||||||    
36639387 acttggatgcttgg 36639400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 206
Target Start/End: Complemental strand, 46937462 - 46937371
Alignment:
115 tgatagagactatatgaccacggggctaggaatttttgggtacataacacaggtccacttggatgcttgggtcaaaatgttgccacatttgg 206  Q
    |||||||||||||||||  | ||||||||  |||| ||| |||| || |||||||| ||||||||||| | ||| |||||||||| ||||||    
46937462 tgatagagactatatgatgagggggctagatatttctggatacacaatacaggtcctcttggatgcttagctcagaatgttgccaaatttgg 46937371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University