View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3263_high_7 (Length: 269)
Name: NF3263_high_7
Description: NF3263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3263_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 19 - 165
Target Start/End: Complemental strand, 45828212 - 45828067
Alignment:
| Q |
19 |
cttatctggtcttaaaagtaatcattttcgccattaaaagtgtcatttgtagtcgtagtagtccatagatcaatgaataatattttaaactatctgatag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45828212 |
cttatctggtcttaaaagtaatcattttcgccattaaaagtgtcatttgtagtcgtagtagtccatagatcaatgaataatattttaaactatctgatag |
45828113 |
T |
 |
| Q |
119 |
gaacctctttgttagccaaataaatttctaacgttttctctagactt |
165 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45828112 |
gaacctctttgttagccaaat-aatttctaacgttttctctagactt |
45828067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 178
Target Start/End: Complemental strand, 45828049 - 45828019
Alignment:
| Q |
148 |
aacgttttctctagacttgaaaccgtttgtt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45828049 |
aacgttttctctagacttgaaaccgtttgtt |
45828019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University