View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3263_low_14 (Length: 231)
Name: NF3263_low_14
Description: NF3263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3263_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 36634462 - 36634663
Alignment:
| Q |
14 |
ataacaatgaatttgttacgttttttattgaaaacattcttgacttgaactccacagtagaaaaattgttttgctgaaattaacattcactctcttattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36634462 |
ataacaatgaatttgttacgttttttattgaaaacattcttgacttgaactccacagtagaaaaattgttttgctgaaattaacattcactctcttattt |
36634561 |
T |
 |
| Q |
114 |
gtgatagagactatatgaccacggggctaggaatttttgggtacataacacaggtccacttggatgcttgggtcaaaatgttgccacatttggccatgat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36634562 |
gtgatagagactatatgaccacggggctaggaatttttgggtacataacacaggtccacttggatgcttgggtcaaaatgttgccacatttggccatgat |
36634661 |
T |
 |
| Q |
214 |
aa |
215 |
Q |
| |
|
|| |
|
|
| T |
36634662 |
aa |
36634663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 74 - 184
Target Start/End: Original strand, 36639287 - 36639400
Alignment:
| Q |
74 |
aaaaattgttttgctgaaattaacattc-actctcttatttgtg--atagagactatatgaccacggggctaggaatttttgggtacataacacaggtcc |
170 |
Q |
| |
|
|||||| ||| ||| |||||| |||||| ||||||||||||||| | ||||||| |||||| ||||| ||||||||| || |||||||| | |||| |
|
|
| T |
36639287 |
aaaaatagttatgcagaaattgacattccactctcttatttgtgtgacagagactgtatgacatcggggtcaggaattttcggatacataacgcgagtcc |
36639386 |
T |
 |
| Q |
171 |
acttggatgcttgg |
184 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36639387 |
acttggatgcttgg |
36639400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 206
Target Start/End: Complemental strand, 46937462 - 46937371
Alignment:
| Q |
115 |
tgatagagactatatgaccacggggctaggaatttttgggtacataacacaggtccacttggatgcttgggtcaaaatgttgccacatttgg |
206 |
Q |
| |
|
||||||||||||||||| | |||||||| |||| ||| |||| || |||||||| ||||||||||| | ||| |||||||||| |||||| |
|
|
| T |
46937462 |
tgatagagactatatgatgagggggctagatatttctggatacacaatacaggtcctcttggatgcttagctcagaatgttgccaaatttgg |
46937371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University