View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3263_low_6 (Length: 332)
Name: NF3263_low_6
Description: NF3263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3263_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 13 - 147
Target Start/End: Complemental strand, 37749463 - 37749329
Alignment:
| Q |
13 |
gagatttgtgaagaaattgcagatttcaagaaacgtaaggatgagggtctgtgaaataacgtgaatagtggaaaggagttgtgaaacaaacaggtacagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37749463 |
gagatttgtgaagaaattgcagatttcaagaaacgtaaggatgagggtctgtgaaataacgtgaatagtggaaaggagttgtgaaacaaacaggtacagt |
37749364 |
T |
|
| Q |
113 |
tatagcactggttttttgagaaacaataagccaaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37749363 |
tatagcactggttttttgagaaacaataaaccaaa |
37749329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 263 - 314
Target Start/End: Complemental strand, 37749218 - 37749167
Alignment:
| Q |
263 |
gcacacccctacgtatataggtacctaaattgttctctcaaacttcgtttgt |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37749218 |
gcacacccctacgtatataggtgcctaaattgttctctcaaacttcgtttgt |
37749167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University