View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3263_low_9 (Length: 250)
Name: NF3263_low_9
Description: NF3263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3263_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 45303832 - 45303586
Alignment:
| Q |
1 |
ttgtttctacaggaatctgtttcaattcaaaggtcagcagcagca---aaagcagatggatggctccaattcgatgaagcagaattacagcaaagaagaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303832 |
ttgtttctacaggaatctgtttcaattcaaaggtcagcagcagcagcaaaagcagatggatggctccaattcgatgaagcagaattacagcaaagaagaa |
45303733 |
T |
 |
| Q |
98 |
actttatggaaaggaatgccacgtggcatatgatgcagttaacttcttcttgtcctacagctagcatgtccaccacaaccacagtaacaactagacttat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303732 |
actttatggaaaggaatgccacgtggcatatgatgcagttaacttcttcttgtcctacagctagcatgtccaccacaaccacagtaacaactagacttat |
45303633 |
T |
 |
| Q |
198 |
ggacccaaaactcatcaagacccatgaactcaacttattcatctcac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45303632 |
ggacccaaaactcatcaagacccatgaactcaacttattcatttcac |
45303586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 50 - 142
Target Start/End: Complemental strand, 45150682 - 45150590
Alignment:
| Q |
50 |
cagatggatggctccaattcgatgaagcagaattacagcaaagaagaaactttatggaaaggaatgccacgtggcatatgatgcagttaactt |
142 |
Q |
| |
|
||||| || |||||||||| |||||||| ||| |||||||| ||||||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
45150682 |
cagatagacggctccaatttgatgaagctgaactacagcaagaaagaaactttatggaaaggaatgtcatgtggcatatgatgctgttaactt |
45150590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 45150492 - 45150446
Alignment:
| Q |
158 |
ctagcatgtccaccacaaccacagtaacaactagacttatggaccca |
204 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
45150492 |
ctagcatggccatcacaaccacagtaacaactacactaatggaccca |
45150446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University