View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3264_high_2 (Length: 273)
Name: NF3264_high_2
Description: NF3264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3264_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 9 - 257
Target Start/End: Complemental strand, 15171503 - 15171255
Alignment:
| Q |
9 |
gagatgaacctgaagagaaacttttcgatgacaaatacagttttgatggttacaagaaactggaattagggatgaatgcgtttgatataatatcgttgtc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15171503 |
gagaagaacctgaagagaaacttttcgatgacaaatacagttttgatggttacaagaaactggaattagggatgaatgcgtttgatataatatcgttgtc |
15171404 |
T |
 |
| Q |
109 |
gtcgggtttgaatttgagtggtttgtttgaaacgacgacgttaaggagtgagaagaggtttacttcaagtgaagaagtgggtgtggttgaggagaaggtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15171403 |
gtcgggtttgaatttgagtggtttgtttgaaacgacgacgttaaggagtgagaagaggtttacttcaagtgaagaagttggtgtggttgaggagaaggtg |
15171304 |
T |
 |
| Q |
209 |
aaggagattggagtgagattagggtttcgggttgagattgggaagaatg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15171303 |
aaggagattggagtgagattagggtttcgggttgagattgggaagaatg |
15171255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 34016881 - 34016817
Alignment:
| Q |
81 |
tgaatgcgtttgatataatatcgttgtcgtcgggtttgaatttgagtggtttgtttgaaacgacg |
145 |
Q |
| |
|
||||||||||| |||||||||| |||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
34016881 |
tgaatgcgtttcatataatatctatgtcttcgggtttggatttgagtggtttatttgaaacgacg |
34016817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University