View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3264_low_4 (Length: 218)
Name: NF3264_low_4
Description: NF3264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3264_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 40940810 - 40940998
Alignment:
| Q |
13 |
agcagagaattaaacgaaatttgctatacaggtcaaagtttgaacatttttgtcccaaataacttactcataannnnnnngctgatttatttaaatgtgc |
112 |
Q |
| |
|
||||||||||| || |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40940810 |
agcagagaattcaaggaaattcgctatacaggtcaaaatttgaacatttttgtcccaaataacttactcataatttttttgctgatttatttaaatgtgc |
40940909 |
T |
 |
| Q |
113 |
tgtagaattttgcaaagagtttacttgatgttgcggataatttgggaagagcttcatcagttgtaaaagaaagtttttccaaaattgat |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40940910 |
tgtagaatttcgcaaagagtttacttgatgttgcggataatttgggaagagcttcatcagttgtaaaagaaagtttttccaaaattgat |
40940998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 113 - 200
Target Start/End: Original strand, 21505120 - 21505207
Alignment:
| Q |
113 |
tgtagaattttgcaaagagtttacttgatgttgcggataatttgggaagagcttcatcagttgtaaaagaaagtttttccaaaattga |
200 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||| || ||||||||||||||||| ||||||||||| || |||||||| |||||||| |
|
|
| T |
21505120 |
tgtagagttttgccaagagtttacttgatgttgctgacaatttgggaagagcttcttcagttgtaaaggacagtttttcaaaaattga |
21505207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University