View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3265_high_10 (Length: 375)
Name: NF3265_high_10
Description: NF3265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3265_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 5 - 356
Target Start/End: Complemental strand, 40776470 - 40776118
Alignment:
| Q |
5 |
gaggagcagagaactatatttgtggggtcagtaaggacccatccctagagactgatattttggtgaccattcatttcatgaggaagtttcatggactaga |
104 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40776470 |
gaggatcagtgaactatatttgtggggtcagtaaggacccatccctagagactgatattttggtgaccattcatttcatgaggaagtttcatggactaga |
40776371 |
T |
 |
| Q |
105 |
tttttctgtttgttgctagagatagagaaagtgcatagctttttccatgtgtgttaggttgccactcattcctcatcaaatttc-aaaggggaaatggac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40776370 |
tttttctgtttgttgctagagatagagaaagtgcatagctttttccatgtgtgttaggttgccactcattcctcatcaaatttcaaaaggggaaatggac |
40776271 |
T |
 |
| Q |
204 |
aagctagttcaactcaacgagattttacgtccacaaaaaattcatataattttcacgaaaaacaattatattgttgtgaaagataggatttacgtgtatt |
303 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40776270 |
aagctagttcaacgcaacgagatttcaagtccacaaaaaattcatataattttaacgaaaaataattatattgttgtgaaagataggatttacgtgtatt |
40776171 |
T |
 |
| Q |
304 |
tattttaacgcatcannnnnnncttcttgtgcaagtttaacgtatcatcgggg |
356 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40776170 |
tattttaacgcatcatttttttcttcttgtgcaagtttaacgtatcatcgggg |
40776118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University