View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3265_high_16 (Length: 271)
Name: NF3265_high_16
Description: NF3265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3265_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 20 - 258
Target Start/End: Complemental strand, 12616395 - 12616157
Alignment:
| Q |
20 |
ttccccaaattcgatcttaggggaaaggattatacctattgacctaccaatgatagacctatcagctgaaaaatcaatggtaataaaactcatagtaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616395 |
ttccccaaattcgatcttaggggaaaggattatacctattgacctaccaatgatagacctatcagctgaaaaatcaatggtaataaaactcatagtaaaa |
12616296 |
T |
|
| Q |
120 |
gcttgtgaagaatatggtttcttcaatgtgattaaccatggtgtcccttatgacatcatatccaaaatggaagaagtaggttttgatttctttgcaaaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616295 |
gcttgtgaagaatatggtttcttcaatgtgattaaccatggtgtccctcatgacatcatatccaaaatggaagaagtaggttttgatttctttgcaaaac |
12616196 |
T |
|
| Q |
220 |
caatggaacaaaagaaactagttgcacctggtaatccct |
258 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12616195 |
caatggaacaaaagaaactagttgcacttggtaatccct |
12616157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 29878124 - 29878072
Alignment:
| Q |
108 |
ctcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatgg |
160 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||| || || |||||||| |
|
|
| T |
29878124 |
ctcatagtaaaagcttgtgaagattttggattcttcaaagtcataaaccatgg |
29878072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University