View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3265_high_17 (Length: 257)
Name: NF3265_high_17
Description: NF3265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3265_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 24 - 242
Target Start/End: Complemental strand, 12616000 - 12615777
Alignment:
| Q |
24 |
aatatatcattggccaaatcttttgcatttattgcatgcttggtttactatac--tatcatgaacaatgacggtataaactgcttgnnnnnnn---aatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12616000 |
aatatatcattggccaaatcttttgcatttattgcatgcttggtttagtatacactatcatgaacaatgacggtataaactgcttggtttttttttaatc |
12615901 |
T |
|
| Q |
119 |
agggtgacaacatgtcttgaacaaatatgatatgaataataatttggaaaattgtggggctatgtaatttcttttgttgttcattttctttagatcgtta |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12615900 |
agggtgacaacatgtcttgaagaaatatgatatgaataataatttggaaaattgtggggctatgtaatttcttttgttgttcattttctttagatcgtta |
12615801 |
T |
|
| Q |
219 |
tagtttttatttggtcccccctat |
242 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
12615800 |
tagttttcatttggtcccccctat |
12615777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University