View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3265_high_19 (Length: 250)
Name: NF3265_high_19
Description: NF3265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3265_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 247
Target Start/End: Complemental strand, 8656738 - 8656504
Alignment:
| Q |
14 |
agacaacacaatggagaacaaatttaggtttctctctaaattaagcttata-atgtctgaactatgataaaattgtgcttcaattttgggttggatctaa |
112 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8656738 |
agacaacacaatggagaaaaattttaggtttctctctaaattaagcttatatatatctgaactatgttaaaattgtgcttcaattttgggttggatctaa |
8656639 |
T |
 |
| Q |
113 |
gtatgaagtgagtttgactttggtgtttacactaatgggtatggatcggtcggaatcgaatttcgctgttctgaaaaaccccacccgagaccgaccctgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656638 |
gtatgaagtgagtttgactttggtgtttacactaatgggtatgggtcggtcggaatcggatttcgctgttctgaaaaaccccacccgagaccgaccctgc |
8656539 |
T |
 |
| Q |
213 |
caaaccaccataacccagttacctgtatgagtagc |
247 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
8656538 |
caaaccaccataacccagttacttgtatgagtagc |
8656504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University