View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3265_high_9 (Length: 403)
Name: NF3265_high_9
Description: NF3265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3265_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 16 - 387
Target Start/End: Complemental strand, 18722904 - 18722533
Alignment:
| Q |
16 |
aacacaatgctagaaacacaaaaatcctgcatgcccatttgcttaaaactcattatttacaatctggtatctttttcatggactcattgattggtttgta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18722904 |
aacacaatgctagaaacacaaaaatcctgcatgcccatttgcttaaaactcattatttacaatctggtatctttttcatggactcattgattggtttgta |
18722805 |
T |
 |
| Q |
116 |
ttgtaaatcttctgatatggttcttgctcataagctgttcgatacaattactcaacccagtattgtttcttggaatgttatgatatctggttacgttcgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18722804 |
ttgtaaatcttctgatatggttcttgctcataagctgttcgatacaattactcaaccgagtattgtttcttggaatgttatgatatctggttacgttcgt |
18722705 |
T |
 |
| Q |
216 |
aattcgatgtttttgaagtcgttggagatgttttgtaggatgcatttgtttggctttgagcctgatgagtttagttatgggagtgttctttctgattgtg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18722704 |
aattcgatgtttttgaagtcgttggagatgttttgtaggatgcatttgtttggttttgagcctgatgagtttagttatgggagtgttctttctgcttgtg |
18722605 |
T |
 |
| Q |
316 |
ttgctttgcaggcttcgatgttcggtttgcaagttttttcacttgttgtgaaaaatggttttttgtcgagtg |
387 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18722604 |
ttgctttgcaggcttcgatgtttggtttgcaagttttttcacttgttgtgaaaaatggttttttgtcgagtg |
18722533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University