View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3265_low_16 (Length: 281)
Name: NF3265_low_16
Description: NF3265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3265_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 97 - 267
Target Start/End: Original strand, 10376487 - 10376659
Alignment:
| Q |
97 |
gaaggaaaatttgaagaataaaaagaggggtaacgtctcaagaatcaaagaagatacaaatggagttcgacggaaatcaggcaaagcgtggtgtaaaaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10376487 |
gaaggaaaatttgaagaataaaaagaggggtaacgtctcaagaatcaaagaagatacgaatggagttcgacggaaatcaggcaaagcgtggtgtaaaaaa |
10376586 |
T |
 |
| Q |
197 |
tgggttgtttaagccatactagtaaaaagccacaatggaatgaag--aatagttggtttttgaatgtcatttt |
267 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10376587 |
tgggttgtttaagccatactagtaaaatgccacaatggaatgaagaaaatagttggtttttgaatgtcatttt |
10376659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 39 - 90
Target Start/End: Original strand, 10375675 - 10375726
Alignment:
| Q |
39 |
aagccatatggaagtcaagtacaaatggtgtttgttcttcatattttattta |
90 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10375675 |
aagccatatggaagtcaaatacaaatggtgtttgttcttcatattttattta |
10375726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University