View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3265_low_24 (Length: 235)
Name: NF3265_low_24
Description: NF3265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3265_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 33555918 - 33556120
Alignment:
| Q |
17 |
atataccgagtgtattttgcttgtctaatactaaaaagtattcatcttcnnnnnnnnnn-actaaagatagtatttatcttattttattattaatgcttt |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33555918 |
atatactgagtgtattttgcttgtctaatactacca-gtattcatcttcttttttttttgactaaagatagtatttatcttattttattattaatgcttt |
33556016 |
T |
 |
| Q |
116 |
agaatttgtaataaaaaggcatttaggccgttgctgtggagtatttggtgttttgacattgtttttacaaagtaaattgcatgttaattgtttgtcgtgc |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33556017 |
agaatttgtaataaaaaggcatgtaggccgttgctgtggagtatttggtgttttgacattgtttttacaaagtaaattgcatgttaattgtttgtcgtgc |
33556116 |
T |
 |
| Q |
216 |
ttgt |
219 |
Q |
| |
|
|||| |
|
|
| T |
33556117 |
ttgt |
33556120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University