View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3266_high_11 (Length: 322)
Name: NF3266_high_11
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3266_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 41844822 - 41844737
Alignment:
| Q |
24 |
aatatatcatgaaagtctgagatcaaaccaacaagatagccatattatggctaaattagtttgatggtaaatttatttattgaata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41844822 |
aatatatcatgaaagtctgagatcaaaccaacaagatagccgtattatggctaaattagtttgatggtaaatttatttattgaata |
41844737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 188 - 310
Target Start/End: Complemental strand, 41844640 - 41844517
Alignment:
| Q |
188 |
gactatagacttaattgagaaatctttttaaaataaaaaatgaagataatctctaactagannnnnnnnnnngacaagataatctttacctattt--aga |
285 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||| ||| |
|
|
| T |
41844640 |
gactatagacttaattaaaaaatctttttaaaataaaaaatgaagataatctctaccta-aatttttttttcgacaagataatctttacctatttagaga |
41844542 |
T |
 |
| Q |
286 |
gcatgtacacatttcacccaaccta |
310 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41844541 |
gcatgtacacatttcacccaaccta |
41844517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University