View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3266_high_21 (Length: 245)
Name: NF3266_high_21
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3266_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 2138078 - 2137871
Alignment:
| Q |
20 |
aagcccattggtggttccatggtggttgttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgggagtgtgagtgggagttttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2138078 |
aagcccattggtggttccatggtggttgttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgggagtgttagtgggagttttt |
2137979 |
T |
|
| Q |
120 |
gggctgatgggtcttgtgatgctccggttagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggttgtgtttggttgtgttgttag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2137978 |
gggctgatgggtcttgtgatgctccggttagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggttgtgtttggttgtgttgttag |
2137879 |
T |
|
| Q |
220 |
gtcggatc |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
2137878 |
gtcggatc |
2137871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 198
Target Start/End: Original strand, 20016949 - 20017042
Alignment:
| Q |
105 |
tgagtgggagtttttgggctgatgggtcttgtgatgctccggttagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggt |
198 |
Q |
| |
|
||||||| ||||||||| || || |||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||| ||| ||||| |
|
|
| T |
20016949 |
tgagtggaagtttttggagtgttgagtcttgagatgctccggttagtttttggacaacttgtcggaaatttgatggttcagcttctaccaaggt |
20017042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University