View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3266_high_21 (Length: 245)

Name: NF3266_high_21
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3266_high_21
NF3266_high_21
[»] chr4 (1 HSPs)
chr4 (20-227)||(2137871-2138078)
[»] chr3 (1 HSPs)
chr3 (105-198)||(20016949-20017042)


Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 2138078 - 2137871
Alignment:
20 aagcccattggtggttccatggtggttgttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgggagtgtgagtgggagttttt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2138078 aagcccattggtggttccatggtggttgttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgggagtgttagtgggagttttt 2137979  T
120 gggctgatgggtcttgtgatgctccggttagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggttgtgtttggttgtgttgttag 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2137978 gggctgatgggtcttgtgatgctccggttagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggttgtgtttggttgtgttgttag 2137879  T
220 gtcggatc 227  Q
    ||||||||    
2137878 gtcggatc 2137871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 198
Target Start/End: Original strand, 20016949 - 20017042
Alignment:
105 tgagtgggagtttttgggctgatgggtcttgtgatgctccggttagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggt 198  Q
    ||||||| |||||||||  || || |||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||| ||| |||||    
20016949 tgagtggaagtttttggagtgttgagtcttgagatgctccggttagtttttggacaacttgtcggaaatttgatggttcagcttctaccaaggt 20017042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University