View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3266_high_24 (Length: 218)

Name: NF3266_high_24
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3266_high_24
NF3266_high_24
[»] chr5 (1 HSPs)
chr5 (1-199)||(43327283-43327478)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 43327283 - 43327478
Alignment:
1 ctggtgttgtactgtcctcttccatcccatctgccaaagcaacccacttgatgatgatcttattnnnnnnnnnnnnnnnnntattattaatcttcttatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||   | |||                  |||||||||||||||||||    
43327283 ctggtgttgtactgtcctcttccatcccatctgccaaagcaacccacttgatgat---cctatcatcatcatcatcatcattattattaatcttcttatg 43327379  T
101 aacatgttgagggagaactatcacggcttcaaatccttggcttacaaagacagaagctagattttgcatgggactaacatgtccttgtgcgggataggg 199  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43327380 aacatgttgagggaggactatcacggcttcaaatccttggcttacaaagacagaagctagattttgcatgggactaacatgtccttgtgcgggataggg 43327478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University