View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3266_low_10 (Length: 342)
Name: NF3266_low_10
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3266_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 45177078 - 45177419
Alignment:
| Q |
1 |
tcttcttctagccggtatccttttcttctacttcaaatttcacttcaataatctattatcattcatttgattcattctacttcgtaattttaggtttggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45177078 |
tcttcttctagccggtatccttttcttctacttcaaatttcacttcaataatctattatcattcatttgattcattctacttcgtaattttaggtttggg |
45177177 |
T |
 |
| Q |
101 |
ttcggaaattctgttgtacgacttagaatttgggaagataatgaaatcgttttcggttttcgatggaattcgtgtgcacgggattgcttctagttctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45177178 |
ttcggaaattctgttgtacgacttagaatttgggaagataatgaaatcgttttcggttttcgatggaattcgtgtgcacgggattgcttctagttctgaa |
45177277 |
T |
 |
| Q |
201 |
tttgtgattgcagtgtttggagagaaaagagtgaaaatgtttcggttttctttcaaaaatgacgattttgagagtccacagttaacattgatccatttgt |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45177278 |
tttgtgattgtagtgtttggagagaaaagagtgaaaatgtttcggttttcgttcaaaaatgacgattttgggagtccacagttaacattgatccatttgt |
45177377 |
T |
 |
| Q |
301 |
tgcccaagtttggtcattgggttttggatgtttgcttcctca |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45177378 |
tgcccaagtttggtcattgggttttggatgtttgcttcctca |
45177419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University