View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3266_low_20 (Length: 251)

Name: NF3266_low_20
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3266_low_20
NF3266_low_20
[»] chr5 (1 HSPs)
chr5 (1-233)||(43327009-43327247)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 43327247 - 43327009
Alignment:
1 atgccaaaccattttgaagagtttcttcaaaatcaaaatc------ttgatgatgtatgtttggtggtggttgacttgttggcatcttgggccatacaag 94  Q
    ||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
43327247 atgccaaaccattttgaagagtttcttcaaaatcaaaatcaaaatcttgatgatgtatgtttggttgtggttgacttgttggcatcttgggccatacaag 43327148  T
95 tggcaagcaagtttggtatccctactgctgggttttggccagccatgcttgcatcatatcttttgattgcatccatacctcagatgcttcggactggact 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43327147 tggcaagcaagtttggtatccctactgctgggttttggccagccatgcttgcatcatatcttttgattgcatccatacctcagatgcttcggactggact 43327048  T
195 catctctgatacaggtttgttgcttttttaacaattaaa 233  Q
    |||||||||||||||||||||||||||||||||||||||    
43327047 catctctgatacaggtttgttgcttttttaacaattaaa 43327009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University