View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3266_low_20 (Length: 251)
Name: NF3266_low_20
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3266_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 43327247 - 43327009
Alignment:
| Q |
1 |
atgccaaaccattttgaagagtttcttcaaaatcaaaatc------ttgatgatgtatgtttggtggtggttgacttgttggcatcttgggccatacaag |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43327247 |
atgccaaaccattttgaagagtttcttcaaaatcaaaatcaaaatcttgatgatgtatgtttggttgtggttgacttgttggcatcttgggccatacaag |
43327148 |
T |
 |
| Q |
95 |
tggcaagcaagtttggtatccctactgctgggttttggccagccatgcttgcatcatatcttttgattgcatccatacctcagatgcttcggactggact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327147 |
tggcaagcaagtttggtatccctactgctgggttttggccagccatgcttgcatcatatcttttgattgcatccatacctcagatgcttcggactggact |
43327048 |
T |
 |
| Q |
195 |
catctctgatacaggtttgttgcttttttaacaattaaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327047 |
catctctgatacaggtttgttgcttttttaacaattaaa |
43327009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University