View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3266_low_24 (Length: 239)
Name: NF3266_low_24
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3266_low_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 47836607 - 47836827
Alignment:
| Q |
19 |
ctcccgaaccatgtgatgtttactggtccaacctttgcatcccatacagacaactatggcttcgaaagatattcacatggggggtttctaccaccttcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47836607 |
ctcccgaaccatgtgatgtttactggtccaacctttgcatcccatacagacaactatggcttcgaaagatattcacatggggggtttctaccaccttcat |
47836706 |
T |
 |
| Q |
119 |
gattgtattcctcgcccctgtcacatttgtacaaggcttgactcaaccagaaaagcttgagaaaatgttcccattcttgacagagatacttaaaacgtaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47836707 |
gattgtattcctcgcccctgtcacatttgtacaaggcttgactcaacctgaaaagcttgagaaaatgttcccattcctgacagagatacttaaaacgtaa |
47836806 |
T |
 |
| Q |
219 |
gatattgcacacacaagggtc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47836807 |
gatattgcacacacaagggtc |
47836827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 219
Target Start/End: Complemental strand, 4706753 - 4706681
Alignment:
| Q |
147 |
gtacaaggcttgactcaaccagaaaagcttgagaaaatgttcccattcttgacagagatacttaaaacgtaag |
219 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||||||||||| || || ||| | ||||||||| ||||| |
|
|
| T |
4706753 |
gtacaaggcttgactcaactagaaaaacttcagaaaatgttcccttttctggcaggggtacttaaaaagtaag |
4706681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University